Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGCaMP5-DHFR
(Plasmid #78706)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 78706 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    N/A

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    GCaMP5
  • Species
    Synthetic
  • Insert Size (bp)
    1353
  • Promoter Toxoplasma SAG1 5' UTR

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer taatacgactcactatagggc
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    DHFR
  • Species
    Toxoplasma gondii
  • Insert Size (bp)
    3051

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGCaMP5-DHFR was a gift from Sebastian Lourido (Addgene plasmid # 78706 ; http://n2t.net/addgene:78706 ; RRID:Addgene_78706)
  • For your References section:

    Using a Genetically Encoded Sensor to Identify Inhibitors of Toxoplasma gondii Ca2+ Signaling. Sidik SM, Hortua Triana MA, Paul AS, El Bakkouri M, Hackett CG, Tran F, Westwood NJ, Hui R, Zuercher WJ, Duraisingh MT, Moreno SN, Lourido S. J Biol Chem. 2016 Apr 29;291(18):9566-80. doi: 10.1074/jbc.M115.703546. Epub 2016 Mar 1. 10.1074/jbc.M115.703546 PubMed 26933036