Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

acta 2
(Plasmid #78711)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 78711 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBluescript
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    acta2
  • Alt name
    alpha-SMA
  • Species
    D. rerio (zebrafish)
  • Insert Size (bp)
    349
  • Mutation
    contains bp 1,243–1,591
  • GenBank ID
    NM_212620
  • Entrez Gene
    acta2 (a.k.a. wu:fb63d03)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRV (not destroyed)
  • 3′ cloning site EcoRV (not destroyed)
  • 5′ sequencing primer T7
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Primers used to amplify cDNA:
CCCAGCACTGTCAGGTGATT and CCCATTCCTACCATCACTCC

acta2 promoter = A 300 bp proximal promoter for acta2 and 2165 bp fragment from the acta2 intron 1. The two genomic fragments were fused in a PCR reaction to make a 2465 bp enhancer/promoter construct

Acta2 3'UTR is in reverse orientation with t1440del, t1454c and a1578g compared to reference sequence. Depositor states that these discrepancies do not affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    acta 2 was a gift from Sarah Childs (Addgene plasmid # 78711 ; http://n2t.net/addgene:78711 ; RRID:Addgene_78711)
  • For your References section:

    Spatiotemporal expression of smooth muscle markers in developing zebrafish gut. Georgijevic S, Subramanian Y, Rollins EL, Starovic-Subota O, Tang AC, Childs SJ. Dev Dyn. 2007 Jun;236(6):1623-32. 10.1002/dvdy.21165 PubMed 17474123