-
PurposeA construct with the AIDA surface expression system for display of a passenger protein flanked by His and Myc tags
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 79180 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepKM1D
- Backbone size w/o insert (bp) 3800
- Total vector size (bp) 3600
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameAdhesin Involved in Diffuse Adherence
-
Alt nameAIDA
-
SpeciesSynthetic; E. coli
-
Insert Size (bp)1800
- Promoter lacUV5
-
Tags
/ Fusion Proteins
- His (N terminal on insert)
- Myc (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site BclI (destroyed during cloning)
- 5′ sequencing primer GAGCGGATAACAATTTCACACAGG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAIDA1 was a gift from Gen Larsson (Addgene plasmid # 79180 ; http://n2t.net/addgene:79180 ; RRID:Addgene_79180) -
For your References section:
A dual tag system for facilitated detection of surface expressed proteins in Escherichia coli. Jarmander J, Gustavsson M, Do TH, Samuelson P, Larsson G. Microb Cell Fact. 2012 Sep 3;11:118. doi: 10.1186/1475-2859-11-118. 10.1186/1475-2859-11-118 PubMed 22943700