This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

PGL3-Ogt (-178 to +233 bp)
(Plasmid #79266)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 79266 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    PGL3-Basic
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 4818
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Ogt promoter element
  • Alt name
    Ogt gene fragment -178 to +233 bp
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Ogt (a.k.a. 1110038P24Rik, 4831420N21Rik, AI115525, Ogtl)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer GAGCCCTTAACCCGGAGTT
  • 3′ sequencing primer GGAGCTTCTTGAGATAGAAC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PGL3-Ogt (-178 to +233 bp) was a gift from Steven Jones (Addgene plasmid # 79266 ; http://n2t.net/addgene:79266 ; RRID:Addgene_79266)
  • For your References section:

    E2F1 Transcription Factor Regulates O-linked N-acetylglucosamine (O-GlcNAc) Transferase and O-GlcNAcase Expression. Muthusamy S, Hong KU, Dassanayaka S, Hamid T, Jones SP. J Biol Chem. 2015 Dec 25;290(52):31013-24. doi: 10.1074/jbc.M115.677534. Epub 2015 Nov 2. 10.1074/jbc.M115.677534 PubMed 26527687