pRSETa-Amrose v1
(Plasmid #79537)

• Purpose: pRSETa (Invitrogen) plasmid expressing Amrose variant 1
• Depositing Lab: Randolph Caldwell
• Publication: Schoetz et al PLoS One. 2014 Sep 5;9(9):e107069. doi: 10.1371/journal.pone.0107069. eCollection 2014.

Backbone

• Vector backbone: pRSETa
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 2897
• Total vector size (bp): 3590
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Amrose
• Alt name: eqFP615 variants Amrose v1
• Species: Entacmaea quadricolor
• Insert Size (bp): 696
• Promoter: T7
• Tags / Fusion Proteins:
  • 6xHis (N terminal on backbone)
  • T7 epitope (N terminal on backbone)
  • Xpress tag (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: actagtcctaggGAAATTAATACGACTCACTATAGGGAGA
• 3′ sequencing primer: ATGCTAGTTATTGCTCAGCGGTGGCAGCAGCCAACTCAGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry