pRSETa-Amrose v3
(Plasmid
#79539)
-
PurposepRSETa (Invitrogen) plasmid expressing Amrose variant 3
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 79539 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepRSETa
-
Backbone manufacturerInvitrogen
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAmrose v3
-
SpeciesEntacmaea quadricolor
-
Insert Size (bp)696
- Promoter T7
-
Tags
/ Fusion Proteins
- 6xHis (N terminal on backbone)
- T7 epitope (N terminal on backbone)
- Xpress tag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer actagtcctaggGAAATTAATACGACTCACTATAGGGAGA
- 3′ sequencing primer ATGCTAGTTATTGCTCAGCGGTGGCAGCAGCCAACTCAGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRSETa-Amrose v3 was a gift from Randolph Caldwell (Addgene plasmid # 79539 ; http://n2t.net/addgene:79539 ; RRID:Addgene_79539) -
For your References section:
Usefulness of a Darwinian system in a biotechnological application: evolution of optical window fluorescent protein variants under selective pressure. Schoetz U, Deliolanis NC, Ng D, Pauli J, Resch-Genger U, Kuhn E, Heuer S, Beisker W, Koster RW, Zitzelsberger H, Caldwell RB. PLoS One. 2014 Sep 5;9(9):e107069. doi: 10.1371/journal.pone.0107069. eCollection 2014. PONE-D-12-23517 [pii] PubMed 25192257