pAM-PAT-ProCDKA;1 GW
(Plasmid
#79750)
-
Purpose(Empty Backbone) binary DEST vector for plant expression
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 79750 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneBinary vector pAMPAT-MCS
-
Modifications to backboneexchange of Pro35S to ProCDKA;1
-
Vector typePlant Expression
- Promoter ProCDKA;1
-
Selectable markersBasta
-
Tag
/ Fusion Protein
- none
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberLow Copy
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer gaccggcaacaggattcaatcttaag
- 3′ sequencing primer GAATTAGAAATTTTATTGATAGAAG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byArp Schnittger, Moritz Nowack, Universität Hamburg
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAM-PAT-ProCDKA;1 GW was a gift from Nico Dissmeyer & Arp Schnittger (Addgene plasmid # 79750 ; http://n2t.net/addgene:79750 ; RRID:Addgene_79750) -
For your References section:
A positive signal from the fertilization of the egg cell sets off endosperm proliferation in angiosperm embryogenesis. Nowack MK, Grini PE, Jakoby MJ, Lafos M, Koncz C, Schnittger A. Nat Genet. 2006 Jan;38(1):63-7. Epub 2005 Nov 27. 10.1038/ng1694 PubMed 16311592