-
PurposeFRET-based actinin tension sensors
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 79774 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEGFP c1 derivative
- Backbone size w/o insert (bp) 3953
- Total vector size (bp) 8204
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameActTS-GR
-
Insert Size (bp)4251
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ActTS-GR was a gift from Tetsuya Kitaguchi (Addgene plasmid # 79774 ; http://n2t.net/addgene:79774 ; RRID:Addgene_79774) -
For your References section:
Wide and high resolution tension measurement using FRET in embryo. Yamashita S, Tsuboi T, Ishinabe N, Kitaguchi T, Michiue T. Sci Rep. 2016 Jun 23;6:28535. doi: 10.1038/srep28535. 10.1038/srep28535 PubMed 27335157