pBGC155-MXMT
(Plasmid
#79818)
-
PurposeGFP(S65T)-based BiFC vector for plants (Positive control: MXMT)
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 79818 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneCaMV35S- sGFP(S65T)-NOS vector
-
Backbone manufacturerChiu W
- Backbone size w/o insert (bp) 4180
-
Modifications to backbonecDNA fragments of CaMXMT1 (Uefuji et al. 2003) were subcloned into the BsrGI/NotI sites of pBGC155.
-
Vector typePlant Expression ; Reporter plasmid
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCaMXMT1
-
Alt nameMXMT
-
SpeciesSynthetic
-
Insert Size (bp)1137
- Promoter CaMV 35S promoter
-
Tag
/ Fusion Protein
- GC155/GFP (155–239) (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsrGⅠ (not destroyed)
- 3′ cloning site NotⅠ (not destroyed)
- 5′ sequencing primer TATATGTACAAGATGGAGCTCCAAGAAGTC
- 3′ sequencing primer TATAGCGGCCGCTTACACGTCTGACTTCTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBGC155-MXMT was a gift from Yutaka Kodama & Masamitsu Wada (Addgene plasmid # 79818 ; http://n2t.net/addgene:79818 ; RRID:Addgene_79818) -
For your References section:
Simultaneous visualization of two protein complexes in a single plant cell using multicolor fluorescence complementation analysis. Kodama Y, Wada M. Plant Mol Biol. 2009 May;70(1-2):211-7. doi: 10.1007/s11103-009-9467-0. Epub 2009 Feb 14. 10.1007/s11103-009-9467-0 PubMed 19219406