-
PurposeExpresses RpBphP1-mCherry
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 79832 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepFC15K
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 3000
- Total vector size (bp) 5800
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameBphP1-mCherry
-
Alt nameRpBphP1
-
SpeciesRhodopseudomonas palustris
-
Insert Size (bp)3000
-
GenBank IDNCBI Gene rpa1537 KX063613
- Promoter CMVd1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer ggtaggcgtgtacggtgggag
- 3′ sequencing primer GCA TCA CAA ATT TCA CAA ATA AAG C (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byA RpBphP1 gene of R. palustris (NCBI Gene rpa1537) was provided by E. Giraud (Institute for Research and Development, France).
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
-
Article Citing this Plasmid
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKA-141 was a gift from Vladislav Verkhusha (Addgene plasmid # 79832 ; http://n2t.net/addgene:79832 ; RRID:Addgene_79832) -
For your References section:
A bacterial phytochrome-based optogenetic system controllable with near-infrared light. Kaberniuk AA, Shemetov AA, Verkhusha VV. Nat Methods. 2016 May 9. doi: 10.1038/nmeth.3864. 10.1038/nmeth.3864 PubMed 27159085