This website uses cookies to ensure you get the best experience. By continuing the use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pJMP3
(Plasmid #79875)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 79875 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pDG1731
  • Backbone size w/o insert (bp) 6673
  • Total vector size (bp) 7263
  • Modifications to backbone
    The rfp-targeting sgRNA RR1 was PCR-amplified from pgRNA-bacteria (Addgene #44251) using primers containing the veg promoter and EcoRI sites, digested with EcoRI, then ligated into either pDG1662 digested with EcoRI to generate pJMP2.
  • Vector type
    Bacterial Expression, CRISPR
  • Selectable markers
    Bacillus subtilis spectinomycin marker

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA RR1
  • Alt name
    sgRNA NT
  • Alt name
    anti-RFP sgRNA
  • gRNA/shRNA sequence
    AACTTTCAGTTTAGCGGTCT
  • Species
    Streptococcus pyogenes
  • Promoter veg

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer tgtccgttccatctgtgaga
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The rfp-targeting sgRNARR1 was PCR-amplified from pgRNA-bacteria (Addgene #44251) using primers containing the veg promoter and EcoRI sites, digested with EcoRI, then ligated into either pDG1731 digested with EcoRI to generate pJMP3
  • Terms and Licenses

Depositor Comments

Please note that mutation T23S in the BSU homology region was found during Addgene's quality control. The depositor noted that this mutation does NOT affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJMP3 was a gift from Carol Gross & Stanley Qi (Addgene plasmid # 79875)
  • For your References section:

    A Comprehensive, CRISPR-based Functional Analysis of Essential Genes in Bacteria. Peters JM, Colavin A, Shi H, Czarny TL, Larson MH, Wong S, Hawkins JS, Lu CH, Koo BM, Marta E, Shiver AL, Whitehead EH, Weissman JS, Brown ED, Qi LS, Huang KC, Gross CA. Cell. 2016 Jun 2;165(6):1493-506. doi: 10.1016/j.cell.2016.05.003. Epub 2016 May 26. 10.1016/j.cell.2016.05.003 PubMed 27238023