pMTB2-Avi-Cerulean-Rpl10a
(Plasmid
#79880)
-
PurposeBeta-actin2 promoter driving Avi-tagged protein containing Cerulean protein fused to zebrafish Rpl10a ribosomal unit (Tryon et al. 2012); flanked by Tol2 sequences
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 79880 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMT
- Backbone size w/o insert (bp) 6084
- Total vector size (bp) 7843
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCerulean protein fused to zebrafish Rpl10a ribosomal unit
-
SpeciesD. rerio (zebrafish)
-
Insert Size (bp)1759
-
Entrez Generpl10a (a.k.a. wu:fb94f08, zgc:73082, zgc:86881)
- Promoter Beta-actin2
-
Tag
/ Fusion Protein
- Avi (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer atttaggtgacactatagaagag
- 3′ sequencing primer taatacgactcactatagggag (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byRpl10a ORF (648 bp) obtained from Tol2-zTRAP (Addgene plasmid 42236, Tryon et al. 2012)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMTB2-Avi-Cerulean-Rpl10a was a gift from Tatjana Sauka-Spengler (Addgene plasmid # 79880 ; http://n2t.net/addgene:79880 ; RRID:Addgene_79880) -
For your References section:
Biotagging of Specific Cell Populations in Zebrafish Reveals Gene Regulatory Logic Encoded in the Nuclear Transcriptome. Trinh LA, Chong-Morrison V, Gavriouchkina D, Hochgreb-Hagele T, Senanayake U, Fraser SE, Sauka-Spengler T. Cell Rep. 2017 Apr 11;19(2):425-440. doi: 10.1016/j.celrep.2017.03.045. 10.1016/j.celrep.2017.03.045 PubMed 28402863