pGEM-cytoBirA-2A-mCherry-SV40pA-FKF
(Plasmid
#79887)
-
PurposeDonor cassette containing HA-tagged biotin ligase (BirA), a Thosea asigna virus peptide (2A), mCherry protein and SV40 polyA tail, followed by FRT site-flanked Kanamycin selection gene
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 79887 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGEM-T
- Backbone size w/o insert (bp) 2994
- Total vector size (bp) 6616
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHA-tagged BirA, 2A, mCherry protein and SV40 polyA, followed by FRT site-flanked Kanamycin selection gene
-
SpeciesD. rerio (zebrafish)
-
Insert Size (bp)3622
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacII (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGG
- 3′ sequencing primer ATTTAGGTGACACTATAGAA (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEM-cytoBirA-2A-mCherry-SV40pA-FKF was a gift from Tatjana Sauka-Spengler (Addgene plasmid # 79887 ; http://n2t.net/addgene:79887 ; RRID:Addgene_79887) -
For your References section:
Biotagging of Specific Cell Populations in Zebrafish Reveals Gene Regulatory Logic Encoded in the Nuclear Transcriptome. Trinh LA, Chong-Morrison V, Gavriouchkina D, Hochgreb-Hagele T, Senanayake U, Fraser SE, Sauka-Spengler T. Cell Rep. 2017 Apr 11;19(2):425-440. doi: 10.1016/j.celrep.2017.03.045. 10.1016/j.celrep.2017.03.045 PubMed 28402863