SP_gRNA_pUC19_N_FancF_Left
(Plasmid
#79892)
-
PurposeHuman gRNA expression vector targeting FANCF (site 1 left)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 79892 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUC19
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFancF_Site_1_Left
-
gRNA/shRNA sequenceCCCTACTTCCGCTTTCACCT
-
SpeciesH. sapiens (human)
-
Tag
/ Fusion Protein
- None
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Human gRNA expression vector targeting FANCF-Site 1-Left as described in Nature Biotechnology 32, 569–576 (2014). This gRNA expression vector must be used in combination with pDR348 FANCF
(Plasmid #47510) and a Cas9 D10A nickase to tag FANCF at its N-terminus.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SP_gRNA_pUC19_N_FancF_Left was a gift from Yannick Doyon (Addgene plasmid # 79892 ; http://n2t.net/addgene:79892 ; RRID:Addgene_79892) -
For your References section:
A Scalable Genome-Editing-Based Approach for Mapping Multiprotein Complexes in Human Cells. Dalvai M, Loehr J, Jacquet K, Huard CC, Roques C, Herst P, Cote J, Doyon Y. Cell Rep. 2015 Oct 7. pii: S2211-1247(15)01020-7. doi: 10.1016/j.celrep.2015.09.009. 10.1016/j.celrep.2015.09.009 PubMed 26456817