pRS416gT-GalL-Cas9
(Plasmid #79903)

• Purpose: pRS416 (URA) + RPR1(TetO) promoter with gRNA locus + Tetracycline Repressor + GalL promoter driven Cas9 for yeast expression
• Depositing Lab: Ronald Davis
• Publication: Fu et al Nucleic Acids Res. 2016 May 19. pii: gkw417.

Backbone

• Vector backbone: pRS416
• Backbone size w/o insert (bp): 4898
• Total vector size (bp): 12421
• Vector type: Yeast Expression, CRISPR
• Selectable markers: URA3

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: Cas9
• Species: Synthetic
• Promoter: GalL

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GACGCCACACTGATTCATCAG
• 3′ sequencing primer: TGCTCGGCACCTTGTACTCG

Gene/Insert 2

• Gene/Insert name: guide RNA (gRNA)
• Species: Synthetic
• Promoter: RPR1 promoter with TetO site

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GTTCGTGCACACAGCCC
• 3′ sequencing primer: agtttggcgaacacttcacc

Gene/Insert 3

• Gene/Insert name: Tetracycline Repressor
• Alt name: TetR
• Insert Size (bp): 624
• Promoter: GPM1 promoter

Cloning Information for Gene/Insert 3

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gagtacaaacgcatgaaatcc
• 3′ sequencing primer: CGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAG

Resource Information

• Supplemental Documents:
  • Annotated GenBank file
• A portion of this plasmid was derived from a plasmid made by: GalL Cas9 was obtained from: https://www.addgene.org/43804/

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

For a nice map of all the features on this plasmid check out this benchling map: https://benchling.com/s/28w2TI93/edit