pWUR Cas2
(Plasmid
#80090)
-
PurposeEncodes Cas2
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 80090 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCDF-1b
- Total vector size (bp) 3792
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCas2
-
Entrez Genecas2 (a.k.a. b2754, ECK2749, ygbF)
- Promoter T7
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pWUR Cas2 was a gift from George Church (Addgene plasmid # 80090 ; http://n2t.net/addgene:80090 ; RRID:Addgene_80090) -
For your References section:
Molecular recordings by directed CRISPR spacer acquisition. Shipman SL, Nivala J, Macklis JD, Church GM. Science. 2016 Jun 9. pii: aaf1175. 10.1126/science.aaf1175 PubMed 27284167