Banshee shRandom mCherry
(Plasmid
#80145)
-
Purposeretroviral expression of random shRNA
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 80145 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneBanshee
-
Backbone manufacturerDr. John Rossi, Beckman Research Institute of the City of Hope, CA
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersmCherry
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namerandom shRNA
-
gRNA/shRNA sequenceCCTAGGGTTAGGTCGCCCTCGTTCAAGAGACGAGGGCGACTTAACCTTAGG
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer unknown (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Banshee shRandom mCherry was a gift from Ellen Rothenberg (Addgene plasmid # 80145 ; http://n2t.net/addgene:80145 ; RRID:Addgene_80145)