Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

MELOPS
(Plasmid #80151)

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 80151 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCR3
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5537
  • Total vector size (bp) 8861
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    OCA2
  • Alt name
    P Protein
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2517
  • Mutation
    nonpathologic polymorphism D257A, pore mutation V443I
  • GenBank ID
    NM_000275
  • Entrez Gene
    OCA2 (a.k.a. BEY, BEY1, BEY2, BOCA, D15S12, EYCL, EYCL2, EYCL3, HCL3, P, PED, SHEP1)
  • Promoter CMV
  • Tag / Fusion Protein
    • mNectarine in first luminal loop

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CACCTTCCAGGGTCAAGGA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    This plasmid was derived from pCR3/OCA2-HA (Sitaram A, et al. (2009) Localization to mature melanosomes by virtue of cytoplasmic dileucine motifs is required for human OCA2 function. Mol Biol Cell 20(5):1464–1477)
  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MELOPS was a gift from Santiago Di Pietro (Addgene plasmid # 80151 ; http://n2t.net/addgene:80151 ; RRID:Addgene_80151)
  • For your References section:

    TPC2 controls pigmentation by regulating melanosome pH and size. Ambrosio AL, Boyle JA, Aradi AE, Christian KA, Di Pietro SM. Proc Natl Acad Sci U S A. 2016 May 17;113(20):5622-7. doi: 10.1073/pnas.1600108113. Epub 2016 May 2. 10.1073/pnas.1600108113 PubMed 27140606