-
Purposeretroviral expression of Runx1Fl and mCherry
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 80157 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneBanshee
-
Backbone manufacturerDr. John Rossi, Beckman Research Institute of the City of Hope, CA
-
Vector typeMammalian Expression, Retroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRunx1
-
SpeciesM. musculus (mouse)
-
Entrez GeneRunx1 (a.k.a. AML1, CBF-alpha-2, Cbfa2, Pebp2a2, Pebpa2b)
-
Tags
/ Fusion Proteins
- HA (C terminal on insert)
- IRES-mCherry (C terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GCCCTTTGTACACCCTAAGCCT
- 3′ sequencing primer mCherry-R or TCAAGAAGACAGGGCCAGGTTT (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Banshee Runx1FL mCherry was a gift from Ellen Rothenberg (Addgene plasmid # 80157 ; http://n2t.net/addgene:80157 ; RRID:Addgene_80157)