Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pmCherry_gRNA
(Plasmid #80457)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 80457 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    Clonetech
  • Backbone size w/o insert (bp) 2871
  • Total vector size (bp) 5033
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    sp Cas9 gRNA
  • Alt name
    Streptococcus pyogenes guideRNA
  • Species
    Streptococcus pyogenes
  • Insert Size (bp)
    76
  • Promoter U6

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer CCTCTGACTTGAGCGTCG
  • 3′ sequencing primer AGTAGGAAAGTCCCGTAAGG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    mCherry
  • Insert Size (bp)
    717
  • Promoter chicken β-actin promoter

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer aagggatggttggttggtgg
  • 3′ sequencing primer CCTTTCTCGCCACGTTCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmCherry_gRNA was a gift from Ervin Welker (Addgene plasmid # 80457 ; http://n2t.net/addgene:80457 ; RRID:Addgene_80457)
  • For your References section:

    Crossing enhanced and high fidelity SpCas9 nucleases to optimize specificity and cleavage. Kulcsar PI, Talas A, Huszar K, Ligeti Z, Toth E, Weinhardt N, Fodor E, Welker E. Genome Biol. 2017 Oct 6;18(1):190. doi: 10.1186/s13059-017-1318-8. 10.1186/s13059-017-1318-8 [pii] PubMed 28985763