Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

PB-TAC-OSKM
(Plasmid #80481)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 80481 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBluescript
  • Backbone size w/o insert (bp) 3000
  • Total vector size (bp) 11309
  • Vector type
    Mammalian Expression ; piggyBac transposon

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    OSKM
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    5064
  • Entrez Gene
    Pou5f1 (a.k.a. NF-A3, Oct-3, Oct-3/4, Oct-4, Oct3, Oct3/4, Oct4, Otf-3, Otf-4, Otf3, Otf3-rs7, Otf3g, Otf4)
  • Entrez Gene
    Sox2 (a.k.a. Sox-2, lcc, ysb)
  • Entrez Gene
    Klf4 (a.k.a. EZF, Gklf, Zie)
  • Entrez Gene
    Myc (a.k.a. Myc2, Niard, Nird, bHLHe39)
  • Promoter tetO

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer CCAAAAGACGGCAATATGGT
  • 3′ sequencing primer GCTGTTTTGACCTCCATAGAAGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Requires co-transfection with a piggyBac transposase plasmid for stable genomic integration. If you desire to use transposase with the Materials, you may contact Transposagen or other licensed vendor.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PB-TAC-OSKM was a gift from Knut Woltjen (Addgene plasmid # 80481 ; http://n2t.net/addgene:80481 ; RRID:Addgene_80481)
  • For your References section:

    KLF4 N-terminal variance modulates induced reprogramming to pluripotency. Kim SI, Oceguera-Yanez F, Hirohata R, Linker S, Okita K, Yamada Y, Yamamoto T, Yamanaka S, Woltjen K. Stem Cell Reports. 2015 Apr 14;4(4):727-43. doi: 10.1016/j.stemcr.2015.02.004. Epub 2015 Mar 12. 10.1016/j.stemcr.2015.02.004 PubMed 25772473