This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #80492)


Item Catalog # Description Quantity Price (USD)
Plasmid 80492 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 3000
  • Modifications to backbone
    Homology arms for AAVS1; promoter-less SA-T2A-puro selection cassette
  • Vector type
    Mammalian Expression ; donor vector (human)
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
  • Insert Size (bp)
  • Promoter CAG

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer AGCCTCTGCTAACCATGTTC
  • 3′ sequencing primer ATTAGCCAGAAGTCAGATGC
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Deleted T2 protospacer sequence in HA-R

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAVS1-P-CAG-mCh was a gift from Knut Woltjen (Addgene plasmid # 80492 ; ; RRID:Addgene_80492)
  • For your References section:

    Engineering the AAVS1 locus for consistent and scalable transgene expression in human iPSCs and their differentiated derivatives. Oceguera-Yanez F, Kim SI, Matsumoto T, Tan GW, Xiang L, Hatani T, Kondo T, Ikeya M, Yoshida Y, Inoue H, Woltjen K. Methods. 2015 Dec 18. pii: S1046-2023(15)30181-X. doi: 10.1016/j.ymeth.2015.12.012. 10.1016/j.ymeth.2015.12.012 PubMed 26707206