TR-GFP-3'UTR-HP
(Plasmid
#80596)
-
PurposeExpresses GFP from the CBA promoter. Includes a Csy4 target hairpin in the 3'UTR. Cloned into an Adeno-Associated Virus backbone for packaging into AAV.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 80596 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneTR-GFP
- Backbone size w/o insert (bp) 5927
- Total vector size (bp) 5957
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCsy4 hairpin
-
SpeciesPseudomonas aeruginosa
-
Insert Size (bp)30
- Promoter CBA
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site ClaI (not destroyed)
- 5′ sequencing primer cctgagcaaagaccccaacgagaagcg (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TR-GFP-3'UTR-HP was a gift from Aravind Asokan (Addgene plasmid # 80596 ; http://n2t.net/addgene:80596 ; RRID:Addgene_80596) -
For your References section:
Controlling mRNA stability and translation with the CRISPR endoribonuclease Csy4. Borchardt EK, Vandoros LA, Huang M, Lackey PE, Marzluff WF, Asokan A. RNA. 2015 Nov;21(11):1921-30. doi: 10.1261/rna.051227.115. Epub 2015 Sep 9. 10.1261/rna.051227.115 PubMed 26354771