pQLinkHD-SYNZIP6
(Plasmid
#80662)
-
PurposeEncodes the synthetic coiled coil peptide SYNZIP6
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 80662 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepQE-2
-
Backbone manufacturerQiagen
- Backbone size w/o insert (bp) 4892
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSYNZIP6
-
SpeciesSynthetic
-
Insert Size (bp)165
-
Tag
/ Fusion Protein
- 6xHis (N terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer pQE65, TGAGCGGATAACAATTTCACACAG
- 3′ sequencing primer pQE276, GGCAACCGAGCGTTCTGAAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pQLinkHD-SYNZIP6 was a gift from Amy Keating (Addgene plasmid # 80662 ; http://n2t.net/addgene:80662 ; RRID:Addgene_80662) -
For your References section:
SYNZIP protein interaction toolbox: in vitro and in vivo specifications of heterospecific coiled-coil interaction domains. Thompson KE, Bashor CJ, Lim WA, Keating AE. ACS Synth Biol. 2012 Apr 20;1(4):118-29. 10.1021/sb200015u PubMed 22558529