This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

peSpCas9(1.1)-2×sgRNA (IFT88, donor)
(Plasmid #80769)


Item Catalog # Description Quantity Price (USD)
Plasmid 80769 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
    peSpCas9(1.1)-2×sgRNA (empty, donor)
  • Backbone manufacturer
    Kazuhisa Nakayama Lab. (Addgene plasmid #80768)
  • Backbone size w/o insert (bp) 8935
  • Total vector size (bp) 8937
  • Modifications to backbone
    human IFT88 gRNA#1 sequence was inserted in the first sgRNA expression cassette in the plasmid.
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    IFT88 gRNA#1
  • gRNA/shRNA sequence
  • Species
    H. sapiens (human)
  • GenBank ID
  • Entrez Gene
    IFT88 (a.k.a. D13S1056E, DAF19, TG737, TTC10, hTg737)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer GCTGGCCTTTTGCTCACATGTG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    peSpCas9(1.1)-2×sgRNA (IFT88, donor) was a gift from Kazuhisa Nakayama (Addgene plasmid # 80769 ; ; RRID:Addgene_80769)
  • For your References section:

    Practical method for targeted disruption of cilia-related genes by using CRISPR/Cas9-mediated homology-independent knock-in system. Katoh Y, Michisaka S, Nozaki S, Funabashi T, Hirano T, Takei R, Nakayama K. Mol Biol Cell. 2017 Feb 8. pii: mbc.E17-01-0051. doi: 10.1091/mbc.E17-01-0051. 10.1091/mbc.E17-01-0051 PubMed 28179459