Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSicoR-sh4EBP2
(Plasmid #81121)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 81121 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSicoR
  • Backbone manufacturer
    Jacks Lab (MIT)
  • Backbone size w/o insert (bp) 7567
  • Total vector size (bp) 7609
  • Vector type
    Mammalian Expression, Lentiviral, RNAi, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    4E-BP2 shRNA
  • Alt name
    Eif4ebp2 shRNA
  • gRNA/shRNA sequence
    CGCCTTAATTGAAGACTCCAA
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Eif4ebp2 (a.k.a. 2810011I19Rik, 4E-BP2, AA792569, BC010348, PHAS-II)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HpaI (destroyed during cloning)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer mU6-F
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    pSicoR was obtained from Addgene (plasmid 11579). shRNA insert was synthesized independently but is based on a target sequence from Broad/RNAi Platform (TRCN0000075614)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

pSicoR allows for expression of the 4E-BP2 shRNA in the absence of Cre. Expression of Cre turns off shRNA expression. These plasmids were also used in the following publication "Normalizing translation through 4E-BP prevents mTOR-driven cortical mislamination and ameliorates aberrant neuron integration. Lin TV, Hsieh L, Kimura T, Malone TJ, Bordey A. Proc Natl Acad Sci U S A. 2016 Oct 4;113(40):11330-11335."

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSicoR-sh4EBP2 was a gift from Angelique Bordey (Addgene plasmid # 81121 ; http://n2t.net/addgene:81121 ; RRID:Addgene_81121)
  • For your References section:

    mTORC1 targets the translational repressor 4E-BP2, but not S6 kinase 1/2, to regulate neural stem cell self-renewal in vivo. Hartman NW, Lin TV, Zhang L, Paquelet GE, Feliciano DM, Bordey A. Cell Rep. 2013 Oct 31;5(2):433-44. doi: 10.1016/j.celrep.2013.09.017. Epub 2013 Oct 17. 10.1016/j.celrep.2013.09.017 PubMed 24139800