pSALECTNK-TEM1(S70A,D179G)/csTEM1
(Plasmid
#81163)
-
PurposepSALECT plasmid with TEM-1 beta-lactamase fused to TEM-1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 81163 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSALECT
- Backbone size w/o insert (bp) 3224
- Total vector size (bp) 4013
-
Modifications to backboneAddition of a codon-swapped fusion beta-lactamase with a c-terminal Hix6x tag followed by a BbvCI nicking site.
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsFor plasmid production a general cloning strain with this plasmid can grown at 30 or 37oC. For selection on ampicillin the temperature is limited to 30oC in a strain that has lacI knocked-out (the strain MC4100 is best suited for this).
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTEM-1 beta-lactamase
-
SpeciesSynthetic
-
Insert Size (bp)789
-
MutationDeleted the sec transport tag. Plasmid encodes H26 to W290. Mutations S70A, D179G.
-
GenBank IDWP_054579850
- Promoter lac promoter
-
Tags
/ Fusion Proteins
- Codon swapped TEM-1 from H26 to W290 (C terminal on backbone)
- His6x (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer GGTTTCCCGACTGGAAAG
- 3′ sequencing primer AGGGCAGGGTCGTTAAATAGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSALECTNK-TEM1(S70A,D179G)/csTEM1 was a gift from Timothy Whitehead (Addgene plasmid # 81163 ; http://n2t.net/addgene:81163 ; RRID:Addgene_81163) -
For your References section:
Trade-offs between enzyme fitness and solubility illuminated by deep mutational scanning. Klesmith JR, Bacik JP, Wrenbeck EE, Michalczyk R, Whitehead TA. Proc Natl Acad Sci U S A. 2017 Feb 14. pii: 201614437. doi: 10.1073/pnas.1614437114. 10.1073/pnas.1614437114 PubMed 28196882