This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #81224)


Item Catalog # Description Quantity Price (USD)
Plasmid 81224 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 6900
  • Total vector size (bp) 6900
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    gix-Neo-gix deletion cassette upstream of EGFP
  • Species
  • Insert Size (bp)
  • Promoter pCBa

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer GCCTTCTTCTTTTTCCTACAGC
  • 3′ sequencing primer CGCATCGAGCGAGCAC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCALNL_Ch10 was a gift from David Liu (Addgene plasmid # 81224 ; ; RRID:Addgene_81224)
  • For your References section:

    A programmable Cas9-serine recombinase fusion protein that operates on DNA sequences in mammalian cells. Chaikind B, Bessen JL, Thompson DB, Hu JH, Liu DR. Nucleic Acids Res. 2016 Aug 11. pii: gkw707. 10.1093/nar/gkw707 PubMed 27515511