pCas57
(Plasmid
#82395)
-
PurposesgRNA targeting YFP +111 from TSS; template strand; expressed from aTc inducible system in pEZ03 in the NS1 locus with kanamycin resistance
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 82395 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUC19
- Total vector size (bp) 6423
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNA
-
gRNA/shRNA sequenceYFP
- Promoter PEZ3
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TTGGGTAACGCCAGGGT
- 3′ sequencing primer GCTTCCGGCTCGTATGTTGTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCas57 was a gift from Brian Pfleger (Addgene plasmid # 82395 ; http://n2t.net/addgene:82395 ; RRID:Addgene_82395) -
For your References section:
CRISPR interference as a titratable, trans-acting regulatory tool for metabolic engineering in the cyanobacterium Synechococcus sp. strain PCC 7002. Gordon GC, Korosh TC, Cameron JC, Markley AL, Begemann MB, Pfleger BF. Metab Eng. 2016 Jul 29. pii: S1096-7176(16)30062-3. doi: 10.1016/j.ymben.2016.07.007. 10.1016/j.ymben.2016.07.007 PubMed 27481676