-
PurposeExpresses full length sfCherry2 and TagBFP fusion in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 83031 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepHR-SFFV
- Backbone size w/o insert (bp) 9000
- Total vector size (bp) 10401
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesfCherry+full length_TagBFP
-
SpeciesSynthetic
-
Insert Size (bp)1518
-
Mutation3 mutations in sfCherry full length: E118Q, T128I, and G220A
- Promoter SFFV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GCTTCTGCTTCCCGAGCTCTA (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSFFV_sfCherry2_TagBFP was a gift from Bo Huang (Addgene plasmid # 83031 ; http://n2t.net/addgene:83031 ; RRID:Addgene_83031) -
For your References section:
Improved split fluorescent proteins for endogenous protein labeling. Feng S, Sekine S, Pessino V, Li H, Leonetti MD, Huang B. Nat Commun. 2017 Aug 29;8(1):370. doi: 10.1038/s41467-017-00494-8. 10.1038/s41467-017-00494-8 PubMed 28851864