pAD-CMV-STAT5A-DN-CMV-GFP
(Plasmid
#83252)
-
PurposeAdenoviral expression of STAT5A dominant negative with co-expression of GFP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 83252 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAD/CMV/V5-DEST
-
Backbone manufacturerInvitrogen
-
Vector typeAdenoviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameStat5a
-
Alt nameSignal transducer and activator of transcription 5A
-
SpeciesM. musculus (mouse)
-
MutationC-terminal deletion of 135 nucleotides (dominant negative)
-
Entrez GeneStat5a (a.k.a. STAT5)
- Promoter CMV
Cloning Information for Gene/Insert 1
- Cloning method Gateway Cloning
- 5′ sequencing primer T7 (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameeGFP
-
Speciesjellyfish
- Promoter CMV
Cloning Information for Gene/Insert 2
- Cloning method Gateway Cloning
- 5′ sequencing primer GGTCTATATAAGCAGAGCTGGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAD-CMV-STAT5A-DN-CMV-GFP was a gift from Andrew Brooks (Addgene plasmid # 83252 ; http://n2t.net/addgene:83252 ; RRID:Addgene_83252) -
For your References section:
STAT5 Activation in the Dermal Papilla Is Important for Hair Follicle Growth Phase Induction. Legrand JM, Roy E, Ellis JJ, Francois M, Brooks AJ, Khosrotehrani K. J Invest Dermatol. 2016 Sep;136(9):1781-91. doi: 10.1016/j.jid.2016.04.014. Epub 2016 Apr 27. 10.1016/j.jid.2016.04.014 PubMed 27131881