1
Plasmid Cart
Login to add to cart
Recently Visited
Plasmid 8328: pgex-cIAP1
  • cIAP1

  • 1700

  • H. sapiens (human)

  • BIRC2 (API1, MIHB, HIAP2, RNF48, cIAP1, Hiap-2, c-IAP1)

  • GST

  • N terminal on backbone

  • pGEX
    (Search Vector Database)

  • amersham

  • Bacterial Expression

  • 4900

  • BamH1

  • No

  • NotI

  • No

  • GGGCTGGCAAGCCACGTTTGGTGG List of Sequencing Primers

  • TCCGGGAGCTGCATGTGTCAGAGG

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • View sequences (1)
  • Jon Ashwell

  • MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: TNF-RII and c-IAP1 mediate ubiquitination and degradation of TRAF2. Li et al (Nature 2002 Mar 21;416(6878):345-7. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 8328" in your Materials and Methods section.