pJAG98-mTurquoise2-FHA2-AURKB substrate-YPet
(Plasmid #83286)

• Purpose: untargeted Aurora B FRET sensor with mTurquoise2 and YPet FRET pair
• Depositing Lab: Daniel Needleman
• Publication: Yoo et al Elife. 2018 Jul 25;7. pii: 36392. doi: 10.7554/eLife.36392.

Backbone

• Vector backbone: pJAG98 (pBABE-blast)
• Backbone size w/o insert (bp): 4993
• Total vector size (bp): 6970
• Modifications to backbone: None
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mTurquoise2-FHA2-AURKB substrate-YPet
• Alt name: Aurora B FRET sensor
• Insert Size (bp): 1998

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CTTTATCCAGCCCTCAC
• 3′ sequencing primer: ACCCTAACTGACACACATTCC

Resource Information

• Supplemental Documents:
  • Full sequence of pJAG98-mTurquoise2-FHA2-AURKB substrate-YPet

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry