Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pET28a-soNadV
(Plasmid #83363)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 83363 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pET28a(+)
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 5227
  • Total vector size (bp) 6721
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    nadV
  • Alt name
    nicotinamide phosphoribosyltransferase
  • Alt name
    NAMPT
  • Species
    Shewanella oneidensis MR-1
  • Insert Size (bp)
    1484
  • GenBank ID
    1169740

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

nadV gene has been codon optimized for E. coli expression

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET28a-soNadV was a gift from George Cătălin Marinescu (Addgene plasmid # 83363 ; http://n2t.net/addgene:83363 ; RRID:Addgene_83363)
  • For your References section:

    beta-nicotinamide mononucleotide (NMN) production in Escherichia coli. Marinescu GC, Popescu RG, Stoian G, Dinischiotu A. Sci Rep. 2018 Aug 16;8(1):12278. doi: 10.1038/s41598-018-30792-0. 10.1038/s41598-018-30792-0 PubMed 30115969