-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 8340 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGEX
-
Backbone manufactureramersham
- Backbone size w/o insert (bp) 4900
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameXIAP
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1500
-
Entrez GeneXIAP (a.k.a. API3, BIRC4, IAP-3, ILP1, MIHA, XLP2, hIAP-3, hIAP3)
-
Tag
/ Fusion Protein
- GST (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamH1 (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GGGCTGGCAAGCCACGTTTGGTGG
- 3′ sequencing primer TCCGGGAGCTGCATGTGTCAGAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEX-XIAP was a gift from Jon Ashwell (Addgene plasmid # 8340 ; http://n2t.net/addgene:8340 ; RRID:Addgene_8340) -
For your References section:
Ubiquitin protein ligase activity of IAPs and their degradation in proteasomes in response to apoptotic stimuli. Yang Y, Fang S, Jensen JP, Weissman AM, Ashwell JD. Science 2000 May 5;288(5467):874-7. 10.1126/science.288.5467.874 PubMed 10797013