This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed December 24th & 25th and December 31st & January 1st. For details, see our holiday shipping schedule. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #83842)


Item Catalog # Description Quantity Price (USD)
Plasmid 83842 Standard format: Plasmid sent in bacteria as agar stab 1 $65
Lentiviral Prep 83842-LV Virus (1 mL at titer ≥ 1x10⁶ TU/mL) and Plasmid. More Information
Concentrated Lentiviral Prep 83842-LVC Virus (50 µL at titer ≥ 1×10⁸ TU/mL) and Plasmid. More Information

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 6500
  • Total vector size (bp) 9434
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer agctggtttagtgaaccgtcagatc
  • 3′ sequencing primer ggaaccggaacccttaaaca
  • (Common Sequencing Primers)

Resource Information

Information for Lentiviral Prep (Catalog # 83842-LV) ( Back to top )


Ready-to-use Lentiviral Prep particles produced from pLL3.7m-mTurquoise2-SLBP(18-126)-IRES-H1-mMaroon1 (#83842). In addition to the viral particles, you will also receive purified pLL3.7m-mTurquoise2-SLBP(18-126)-IRES-H1-mMaroon1 plasmid DNA.

Lentiviral particles carrying pLL3.7m-mTurquoise2-SLBP(18-126)-IRES-H1-mMaroon1.


  • Volume 1 mL
  • Titer ≥1x10⁶ TU/mL
  • Pricing $100 USD for preparation of 1 mL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids psPAX2 (plasmid #12260)
  • Envelope pMD2.G (plasmid #12259)
  • Buffer OptiPRO SFM


Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Resource Information

Viral Quality Control

Titering Method:
  • Proviral Integration Assay: Lenti-X 293T cells were serially transduced with 83842-LV or a control virus of known titer. 72 hours after transduction cells were harvested, and gDNA extracted and assessed for integrated copies of WPRE.
  • PCR confirmation of insert: PCR was carried out with primers targeting the U6 promoter and mTurquoise2. The PCR product was visualized on an agarose gel for size confirmation.
  • Confirmation of protein expression: HeLa cells were transduced with 83842-LV. Cells were collected, lysed, and tested for mTurquoise2-SLBP expression via immunoblotting. You can view the stable cell line expression data here or in the image section at the top of this page. Read our protocol for generating stable cell lines here.

Visit our viral production page for more information.

Information for Concentrated Lentiviral Prep (Catalog # 83842-LVC) ( Back to top )


Ready-to-use Concentrated Lentiviral Prep particles produced from pLL3.7m-mTurquoise2-SLBP(18-126)-IRES-H1-mMaroon1 (#83842). In addition to the viral particles, you will also receive purified pLL3.7m-mTurquoise2-SLBP(18-126)-IRES-H1-mMaroon1 plasmid DNA.

Concentrated lentiviral particles carrying pLL3.7m-mTurquoise2-SLBP(18-126)-IRES-H1-mMaroon1.


  • Volume 50 µL
  • Titer ≥1×10⁸ TU/mL
  • Pricing $150 USD for preparation of 50 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids psPAX2 (plasmid #12260)
  • Envelope pMD2.G (plasmid #12259)
  • Buffer PBS
  • Purification Lentivirus was concentrated by precipitation in polyethylene glycol (PEG) followed by centrifugation.


Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Resource Information

Viral Quality Control

Titering Method:
  • Proviral Integration Assay: Description of titering method: Lenti-X 293T cells were serially transduced with 83842-LVC or a control virus of known titer. 72 hours after transduction cells were harvested, and gDNA extracted and assessed for integrated copies of WPRE.
  • Quality control was performed on this lentiviral preparation prior to concentration. Results and explanations of quality control methods can be seen in the Information for Lentiviral Prep section on this page.

Visit our viral production page for more information.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLL3.7m-mTurquoise2-SLBP(18-126)-IRES-H1-mMaroon1 was a gift from Michael Lin (Addgene plasmid # 83842 ; ; RRID:Addgene_83842)

    For viral preps, please replace (Addgene plasmid # 83842) in the above sentence with: (Addgene viral prep # 83842-LV) or (Addgene viral prep # 83842-LVC)

  • For your References section:

    Fluorescent indicators for simultaneous reporting of all four cell cycle phases. Bajar BT, Lam AJ, Badiee RK, Oh YH, Chu J, Zhou XX, Kim N, Kim BB, Chung M, Yablonovitch AL, Cruz BF, Kulalert K, Tao JJ, Meyer T, Su XD, Lin MZ. Nat Methods. 2016 Oct 31. doi: 10.1038/nmeth.4045. 10.1038/nmeth.4045 PubMed 27798610