This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #83890)


Item Catalog # Description Quantity Price (USD)
Plasmid 83890 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Total vector size (bp) 15000
  • Vector type
    Lentiviral, CRISPR
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    humanized dead Cas9 KRAB
  • Species
    S. Pyogenes
  • Mutation
    D10A and H840A
  • Promoter Human Ubiquitin C Promoter
  • Tag / Fusion Protein
    • Flag (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TGGACGCCACACTGATTCAT
  • 3′ sequencing primer CTACCGGTGGATGTGGAATG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    aminoglycoside phosphotransferase from E. coli
  • Alt name
  • Alt name
    Hygromycin resistance gene
  • Species
    E. coli
  • Insert Size (bp)
  • Promoter mouse phosphoglycerate kinase 1 promoter

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer AGCTTACTAAGCCAGATGTG
  • 3′ sequencing primer ATGAAAGCCATACGGGAAGC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLV-dCas9-KRAB-PGK-HygR was a gift from Charles Gersbach (Addgene plasmid # 83890)
  • For your References section:

    CRISPR-Cas9 epigenome editing enables high-throughput screening for functional regulatory elements in the human genome. Klann TS, Black JB, Chellappan M, Safi A, Song L, Hilton IB, Crawford GE, Reddy TE, Gersbach CA. Nat Biotechnol. 2017 Apr 3. doi: 10.1038/nbt.3853. 10.1038/nbt.3853 PubMed 28369033