Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pLentiCRISPRv1-sgSHMT1-G3
(Plasmid #83903)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 83903 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLentiCRISPRv1
  • Backbone size w/o insert (bp) 11565
  • Total vector size (bp) 11589
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Serine hydroxymethyltransferase 1
  • Alt name
    SHMT1
  • gRNA/shRNA sequence
    CACCGGAACGGGGCGTATCTCATGG
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_004169.4
  • Entrez Gene
    SHMT1 (a.k.a. CSHMT, SHMT)
  • Promoter hU6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (unknown if destroyed)
  • 3′ cloning site BsmBI (unknown if destroyed)
  • 5′ sequencing primer CCCAGAGAGGGCCTATTTCCCA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLentiCRISPRv1-sgSHMT1-G3 was a gift from David Sabatini (Addgene plasmid # 83903 ; http://n2t.net/addgene:83903 ; RRID:Addgene_83903)
  • For your References section:

    A PHGDH inhibitor reveals coordination of serine synthesis and one-carbon unit fate. Pacold ME, Brimacombe KR, Chan SH, Rohde JM, Lewis CA, Swier LJ, Possemato R, Chen WW, Sullivan LB, Fiske BP, Cho S, Freinkman E, Birsoy K, Abu-Remaileh M, Shaul YD, Liu CM, Zhou M, Koh MJ, Chung H, Davidson SM, Luengo A, Wang AQ, Xu X, Yasgar A, Liu L, Rai G, Westover KD, Vander Heiden MG, Shen M, Gray NS, Boxer MB, Sabatini DM. Nat Chem Biol. 2016 Jun;12(6):452-8. doi: 10.1038/nchembio.2070. Epub 2016 Apr 25. 10.1038/nchembio.2070 PubMed 27110680