pLentiCRISPRv1-sgAAVS1
(Plasmid
#83906)
-
Purposestable knockout
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 83906 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLentiCRISPRv1
- Backbone size w/o insert (bp) 11565
- Total vector size (bp) 11589
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameadeno-associated virus integration site 1
-
Alt nameAAVS1
-
gRNA/shRNA sequenceCACCGGGGCCACTAGGGACAGGAT
-
SpeciesH. sapiens (human)
-
Entrez GeneAAVS1 (a.k.a. AAV)
- Promoter hU6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (unknown if destroyed)
- 3′ cloning site BsmBI (unknown if destroyed)
- 5′ sequencing primer CCCAGAGAGGGCCTATTTCCCA (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLentiCRISPRv1-sgAAVS1 was a gift from David Sabatini (Addgene plasmid # 83906 ; http://n2t.net/addgene:83906 ; RRID:Addgene_83906) -
For your References section:
A PHGDH inhibitor reveals coordination of serine synthesis and one-carbon unit fate. Pacold ME, Brimacombe KR, Chan SH, Rohde JM, Lewis CA, Swier LJ, Possemato R, Chen WW, Sullivan LB, Fiske BP, Cho S, Freinkman E, Birsoy K, Abu-Remaileh M, Shaul YD, Liu CM, Zhou M, Koh MJ, Chung H, Davidson SM, Luengo A, Wang AQ, Xu X, Yasgar A, Liu L, Rai G, Westover KD, Vander Heiden MG, Shen M, Gray NS, Boxer MB, Sabatini DM. Nat Chem Biol. 2016 Jun;12(6):452-8. doi: 10.1038/nchembio.2070. Epub 2016 Apr 25. 10.1038/nchembio.2070 PubMed 27110680