-
PurposegRNA cassette-carrying vector with natMX marker
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 83947 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonep426-SNR52p-gRNA.CAN1.Y-SUP4t
-
Backbone manufacturerGeorge Church lab, Dicarlo et al Nucleic Acids Res
-
Vector typeYeast Expression
-
Selectable markersnourseothricin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNA targeting ADE2 gene
-
gRNA/shRNA sequenceaattgtagagactatccaca
-
SpeciesS. cerevisiae (budding yeast)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCfB2311 (SNR52p-gRNA.ADE2-SUP4t_natMX) was a gift from Irina Borodina (Addgene plasmid # 83947 ; http://n2t.net/addgene:83947 ; RRID:Addgene_83947) -
For your References section:
CRISPR-Cas system enables fast and simple genome editing of industrial Saccharomyces cerevisiae strains. Stovicek V, Borodina I, Forster J. Metab Eng Commun. 2015 Mar 20;2:13-22. doi: 10.1016/j.meteno.2015.03.001. eCollection 2015 Dec. 10.1016/j.meteno.2015.03.001 PubMed 34150504