pP{ELAV-GeneSwitch}
(Plasmid #83957)

• Purpose: Expresses conditional RU486-dependent GAL4 protein under control of the elav promotor
• Depositing Lab: Haig Keshishian
• Publication: Osterwalder et al Proc Natl Acad Sci U S A. 2001 Oct 23;98(22):12596-601.

Backbone

• Vector backbone: pUAST
• Total vector size (bp): 14502
• Vector type: Insect Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: fusion protein consisting of the GAL4-DBD, human progesterone receptor-ligand-binding domain, and P65-AD
• Alt name: GeneSwitch
• Species: H. sapiens (human), S. cerevisiae (budding yeast)
• Entrez Gene: GAL4 (a.k.a. YPL248C, GAL81)
• Entrez Gene: RELA (a.k.a. AIF3BL3, CMCU, NFKB3, p65)
• Promoter: elav

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: aattaaccctcactaaaggg

Resource Information

• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry