pX601-mCherry
(Plasmid #84039)

• Purpose: Staphylococcus aureus (SaCas9) conjugated with mCherry
• Depositing Lab: Yuet Wai Kan
• Publication: Ye et al Proc Natl Acad Sci U S A. 2016 Sep 20;113(38):10661-5. doi: 10.1073/pnas.1612075113. Epub 2016 Sep 6.

Ordering

Item	Catalog #	Description	Quantity	Price (USD)
Plasmid	84039	Standard format: Plasmid sent in bacteria as agar stab	1	$75	Add to Cart

This material is available to academics and nonprofits only.

Backbone

• Vector backbone: pX601
  (Search Vector Database)
• Backbone manufacturer: Feng Zhang's laboratory
• Backbone size w/o insert (bp): 7447
• Total vector size (bp): 8122
• Modifications to backbone: insert cherry down stream of SaCas9
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: mCherry
• gRNA/shRNA sequence: empty vector
• Promoter: T2A
• Tag / Fusion Protein:
  • mCherry (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: EcoR I (not destroyed)
• 5′ sequencing primer: Cas9-HidIII-S: gccccgtcgtgaagagaagcttcatcc
• 3′ sequencing primer: mCherry –EcoR1-AS:cgtagaattcttacttgtacagctcgtccatgccgccggt

Resource Information

• Terms and Licenses:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry