pX601-mCherry
(Plasmid #84039)

• Purpose: Staphylococcus aureus (SaCas9) conjugated with mCherry
• Depositing Lab: Yuet Wai Kan
• Publication: Ye et al Proc Natl Acad Sci U S A. 2016 Sep 20;113(38):10661-5. doi: 10.1073/pnas.1612075113. Epub 2016 Sep 6.

Backbone

• Vector backbone: pX601
• Backbone manufacturer: Feng Zhang's laboratory
• Backbone size w/o insert (bp): 7447
• Total vector size (bp): 8122
• Modifications to backbone: inserted mcherry downstream of SaCas9
• Vector type: Mammalian Expression, AAV, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: SaCas9
• Alt name: SauCas9
• gRNA/shRNA sequence: empty vector
• Species: Staphylococcus aureus
• Promoter: CMV
• Tags / Fusion Proteins:
  • NLS (N terminal on insert)
  • NLS (C terminal on insert)
  • T2A-mCherry (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: EcoR I (not destroyed)
• 5′ sequencing primer: Cas9-HidIII-S: gccccgtcgtgaagagaagcttcatcc
• 3′ sequencing primer: mCherry –EcoR1-AS:cgtagaattcttacttgtacagctcgtccatgccgccggt

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry