This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #84240)


Item Catalog # Description Quantity Price (USD)
Plasmid 84240 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    System Biosciences
  • Total vector size (bp) 15142
  • Vector type
    Mammalian Expression, CRISPR, Synthetic Biology ; PiggyBac
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    GAI-tagBFP-Sp dCas9
  • Species
    A. thaliana (mustard weed), Synthetic; S. pyogenes
  • Insert Size (bp)
  • Promoter PGK
  • Tags / Fusion Proteins
    • GAI (N terminal on insert)
    • tagBFP (N terminal on insert)
    • HA tag (C terminal on insert)
    • 2xNLS (SV40) (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer gaaggtcctccggaggcc
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
  • Species
    A. thaliana (mustard weed), Synthetic
  • Insert Size (bp)
  • Promoter CAG
  • Tags / Fusion Proteins
    • GID1 (N terminal on insert)
    • IRES-Puro (C terminal on backbone)

Cloning Information for Gene/Insert 2

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer tcggcttctggcgtgtga
  • 3′ sequencing primer gacggcaatatggtggaaaataac
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSLQ2812 pPB: CAG-GID1-VPR-IRES-Puro-WPRE PGK-GAI-tagBFP-SpdCas9 was a gift from Stanley Qi (Addgene plasmid # 84240)
  • For your References section:

    Complex transcriptional modulation with orthogonal and inducible dCas9 regulators. Gao Y, Xiong X, Wong S, Charles EJ, Lim WA, Qi LS. Nat Methods. 2016 Oct 24. doi: 10.1038/nmeth.4042. 10.1038/nmeth.4042 PubMed 27776111