Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pEGFP-Merlin
(Plasmid #84293)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 84293 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4731
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Merlin (NF2)
  • Species
    H. sapiens (human)
  • Entrez Gene
    NF2 (a.k.a. ACN, BANF, SCH, SWNV, merlin-1)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (destroyed during cloning)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

WT Merlin

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-Merlin was a gift from Jonathan Chernoff (Addgene plasmid # 84293 ; http://n2t.net/addgene:84293 ; RRID:Addgene_84293)
  • For your References section:

    p21-activated kinase links Rac/Cdc42 signaling to merlin. Xiao GH, Beeser A, Chernoff J, Testa JR. J Biol Chem. 2002 Jan 11. 277(2):883-6. 10.1074/jbc.C100553200 PubMed 11719502