Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

mMaroon-RTK-mMaroon
(Plasmid #84359)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 84359 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    EGFP-C1
  • Backbone size w/o insert (bp) 4000
  • Total vector size (bp) 5700
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mMaroon-Rtk--mMaroon
  • Species
    Synthetic
  • Insert Size (bp)
    1800
  • Promoter CMV
  • Tag / Fusion Protein
    • mMaroon flanking Rtk domain on N and C terminus

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer cggtgggaggtctatataagc
  • 3′ sequencing primer CTCTACAAATGTGGTATGGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mMaroon-RTK-mMaroon was a gift from Ryohei Yasuda (Addgene plasmid # 84359 ; http://n2t.net/addgene:84359 ; RRID:Addgene_84359)
  • For your References section:

    Simultaneous dual-color fluorescence lifetime imaging with novel red-shifted fluorescent proteins. Laviv T, Kim BB, Chu J, Lam AJ, Lin MZ, Yasuda R. Nat Methods. 2016 Oct 31. doi: 10.1038/nmeth.4046. 10.1038/nmeth.4046 PubMed 27798609