-
PurposeLentiviral expression of doxycycline-inducible constitutively active Rac1 and co-expression of Venus
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 84605 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSLIK
-
Backbone manufacturerIain Fraser (Addgene plasmid # 25734)
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersVenus
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRac1
-
SpeciesH. sapiens (human)
-
MutationConstitutively Active, Q61L
-
Entrez GeneRAC1 (a.k.a. MIG5, MRD48, Rac-1, TC-25, p21-Rac1)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer pTYF-5 GTAGACATAATAGCAACAGAC
- 3′ sequencing primer hUBCpro-R CTAAGGCCGAGTCTTATGAGCAG (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSLIK CA Rac1 was a gift from Sanjay Kumar (Addgene plasmid # 84605 ; http://n2t.net/addgene:84605 ; RRID:Addgene_84605) -
For your References section:
Simultaneous and independent tuning of RhoA and Rac1 activity with orthogonally inducible promoters. MacKay JL, Kumar S. Integr Biol (Camb). 2014 Sep;6(9):885-94. doi: 10.1039/c4ib00099d. 10.1039/c4ib00099d PubMed 25044255