Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #84605)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 84605 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Iain Fraser (Addgene plasmid # 25734)
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number


  • Gene/Insert name
  • Species
    H. sapiens (human)
  • Mutation
    Constitutively Active, Q61L
  • Entrez Gene
    RAC1 (a.k.a. MIG5, MRD48, Rac-1, TC-25, p21-Rac1)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer pTYF-5 GTAGACATAATAGCAACAGAC
  • 3′ sequencing primer hUBCpro-R CTAAGGCCGAGTCTTATGAGCAG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSLIK CA Rac1 was a gift from Sanjay Kumar (Addgene plasmid # 84605 ; ; RRID:Addgene_84605)
  • For your References section:

    Simultaneous and independent tuning of RhoA and Rac1 activity with orthogonally inducible promoters. MacKay JL, Kumar S. Integr Biol (Camb). 2014 Sep;6(9):885-94. doi: 10.1039/c4ib00099d. 10.1039/c4ib00099d PubMed 25044255