Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCRISPRyl_MFE1
(Plasmid #84612)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 84612 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pUC19
  • Backbone size w/o insert (bp) 2623
  • Total vector size (bp) 11822
  • Vector type
    Yeast Expression, CRISPR, Synthetic Biology
  • Selectable markers
    LEU2

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cas9
  • gRNA/shRNA sequence
    AGTCTCACCGAAACCAACCA
  • Promoter UAS1B8-TEF(136)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BssHII (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer TEF
  • 3′ sequencing primer CYC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Addgene material #44380 (UAS1B8-TEF promoter) is used to express Cas9
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCRISPRyl_MFE1 was a gift from Ian Wheeldon (Addgene plasmid # 84612 ; http://n2t.net/addgene:84612 ; RRID:Addgene_84612)
  • For your References section:

    Standardized markerless gene integration for pathway engineering in Yarrowia lipolytica. Schwartz C, Shabbir-Hussain M, Frogue K, Blenner M, Wheeldon I. ACS Synth Biol. 2016 Dec 19. 10.1021/acssynbio.6b00285 PubMed 27989123