pSLIK CA ROCK2
(Plasmid
#84649)
-
PurposeLentiviral expression of doxycycline-inducible constitutively active ROCK2 and co-expression of Venus
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 84649 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSLIK
-
Backbone manufacturerIain Fraser (Addgene plasmid # 25734)
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersVenus; Zeo marker is outside the LTRs and will not be packaged into virus.
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameROCK2
-
SpeciesB. taurus (bovine)
-
MutationConstitutive Active (please see depositor comments below)
-
Entrez GeneROCK2 (a.k.a. ROCK-II)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer pTYF-5 GTAGACATAATAGCAACAGAC
- 3′ sequencing primer hUBCpro-R CTAAGGCCGAGTCTTATGAGCAG (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
-
Article Citing this Plasmid
Depositor Comments
The insert contains Y71C, R77K, F184Y, Y199F, R263K, H274N, R343K, T345N, N372T, M374T, T394V, S407N, AND A411T mutations and premature truncation (ends at amino acid 468) compared to reference sequence (NP001308572.1). The depositor states that these mutations do not affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSLIK CA ROCK2 was a gift from Sanjay Kumar (Addgene plasmid # 84649 ; http://n2t.net/addgene:84649 ; RRID:Addgene_84649) -
For your References section:
Constitutive activation of myosin-dependent contractility sensitizes glioma tumor-initiating cells to mechanical inputs and reduces tissue invasion. Wong SY, Ulrich TA, Deleyrolle LP, MacKay JL, Lin JM, Martuscello RT, Jundi MA, Reynolds BA, Kumar S. Cancer Res. 2015 Mar 15;75(6):1113-22. doi: 10.1158/0008-5472.CAN-13-3426. Epub 2015 Jan 29. 10.1158/0008-5472.CAN-13-3426 PubMed 25634210