-
PurposeSecond generation lenti expressing Mash1 and Neurogenin for iN transdifferentation to neurons
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 84777 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonePLVX TIGHT PURO
-
Backbone manufacturerclonetech
- Backbone size w/o insert (bp) 7791
- Total vector size (bp) 9378
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GCAGAGCTCGTTTAGTG
- 3′ sequencing primer CTAAAGCGCATGCTCCAGACTGCC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byJEROME MERTENS
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLVX-TREtight-Ngn2:2A:Ascl1-PGK-Puro (XTP-N2A) was a gift from Fred Gage (Addgene plasmid # 84777 ; http://n2t.net/addgene:84777 ; RRID:Addgene_84777) -
For your References section:
Directly Reprogrammed Human Neurons Retain Aging-Associated Transcriptomic Signatures and Reveal Age-Related Nucleocytoplasmic Defects. Mertens J, Paquola AC, Ku M, Hatch E, Bohnke L, Ladjevardi S, McGrath S, Campbell B, Lee H, Herdy JR, Goncalves JT, Toda T, Kim Y, Winkler J, Yao J, Hetzer MW, Gage FH. Cell Stem Cell. 2015 Oct 6. pii: S1934-5909(15)00408-7. doi: 10.1016/j.stem.2015.09.001. 10.1016/j.stem.2015.09.001 PubMed 26456686