Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pEX-A-U6-MiSgRNA_PuroR
(Plasmid #84781)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 84781 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEX-A
  • Backbone size w/o insert (bp) 5314
  • Total vector size (bp) 5334
  • Vector type
    Mammalian Expression, Bacterial Expression, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    minor satellite-specific sgRNA
  • gRNA/shRNA sequence
    ACACTGAAAAACACATTCGT
  • Promoter U6

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer 5´- GAG GGC CTA TTT CCC ATG ATT C-3´
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEX-A-U6-MiSgRNA_PuroR was a gift from Heinrich Leonhardt (Addgene plasmid # 84781 ; http://n2t.net/addgene:84781 ; RRID:Addgene_84781)
  • For your References section:

    Determination of Local Chromatin Composition by CasID. Schmidtmann E, Anton T, Rombaut P, Herzog F, Leonhardt H. Nucleus. 2016 Sep 27:0. 10.1080/19491034.2016.1239000 PubMed 27676121